Consuming Kids (summary) :: essays research papers fc

Technology & Society (HUM110-80)CONSUMING KIDSSummary on Article, Pubic Attitudes Toward the Youth merchandising Industry & Its Impact on ChildrenFew public opinion polls exist concerning the burgeoning youth marketing industry. We therefore conducted an online survey of 978 U.S. residents in the Spring of 2004. Results extract that a large majority of respondents believe a) that the youth marketing industry is harmful to children and has questionable ethical practices b) that the industry contributes to a variety of problems common in youth c) that most of the marketing which takes place in schools is unacceptable and d) that marketing directed at children low 8 years of age should be out(p), (Kasser and Linn).This survey was born out of concern that there are few statistics on the effects of marketing industrys impact on our youth. besides as the article on Consuming Kids raises awareness about children being lured into believing they cant live without things and the problems rising out of it. This survey makes us aware of how this market is willing to sacrifice the sanctity of family life by undermining the parents via their television while children watch mega hours of uninterrupted commercials aimed at them. These surveys were compared with a couple of sparsely completed other ones. The respondents felt that problems such as aggressiveness, materialism, obesity, lack of creativity, overly sexualized behavior and self-esteem, were detrimentally influenced by the youth marketing industry. The solutions were simple enough, over half(a) believed that schools should be commercial free zones, childrens television should be commercial free, (PBS has it), marketing to children should be subject to more government oversight, marketing to children 12 and under should be prohibited. There has got to be a stemming of the tide of the marketing industry exploiting children at such young ages. The survey results suggested the marketing industrys is pliant its ethi cs for sales, is potentially harmful, needs regulation, the school should not be the place to market their products, even though the schools say it is helping them financially.

The Product of Manchester AirportManchester Airport is a service Essays

The Product of Manchester aerodromeManchester airport is a advantage company. Its products are in general the facilities it provides e.g. the cart tracks and terminal.BUSINESS ACITIVITYThe Product of Manchester dromeManchester airport is a service company. Its products are mainly thefacilities it provides e.g. the runways and terminals and also theservices it offers to its customers i.e. the airlines.The Airport Company acts as landlord and guardian of the in all site providing the infrastructure and main facilities e.g. roads, drains,phones, runways and terminals. Its income comes from the charges andcosts for using the facilities e.g. airlines pay for the runway,handling agents pay for ticket desks and shopkeepers pay rent.The Airport Company is also responsible for1 Marketing and promoting the Airport brand2 Lobbying Government and other authorities3 Environmental standards4 Ensuring a safe and efficient Airport.Products for Airlines and Tour OperatorsManchester Airport off ers products and services directly to airlinesand tour operators, and in other cases acts as landlord and regulatorof services for the may private companies that buzz off the Airportdiverse.RunwaysManchester Airport has two runways, severally 3,050 meters in length.Runways need to be this length to enable aircraft of all sizes andweights to land and take off safely. They operate in segregated mode,which means one runway is used for take offs and the other forlandings.Passenger FacilitiesIn order to process passengers through the Airport, Manchester Airportplc provides facilities such as check-in desks, baggage handlingsystems and a number of high street retail discloselets.SecurityWith the exception of Hold Baggage Screening, Manchester AirportAviation operate (MAAS) is responsible for the aviation security systemservice at the Airport in areas of access control, searching andscreening of passengers and baggage, and ensuring that the Airportcomplies with legislation and guideli nes issued by the De bitment for ship and the International Civil Aviation Organisation. hap baggage may be checked at any time within the Airport area, aspart of the Airports visitor security policy.The US Federal Aviation Authority stipulates that all passengers onflights with US-based carries have an extra security scr... ...byThe Aviation fellowship and has staff of trained guides who leadeducational tours for groups of all ages, providing a structured andinformative introduction of life at the Airport .Aviation Viewing common landSpectacular views can also be seen from the Aviation Viewing Park,which is managed by the Bollin Valley Rangers.EducationThe variety of activities and vibrant of the Airport helps stimulateexciting ideas true fir educational projects. Over the years, the Airportseducational officer has worked with many of the 3,000 schools and alarge number of collages in the immediate catchments area of greaterManchester and Cheshire, as well as others through out the north ofEngland and Wales.NHS Walk-in CentreThis is a one-stop drop in centre for travellers, other visitors tothe Airport and the local participation to ask immediate health cogitatequestions.Occupational health UnitThe centre provides pre-employment medicals for staff working at theAirport and CAA medicals for air crew as well as providingconfidential withstand and advice to employees.Petrol stationsThe Airport owns and manages two petrol stations on site, these arepart of MAVL. The Product of Manchester AirportManchester Airport is a service EssaysThe Product of Manchester AirportManchester Airport is a service company. Its products are mainly the facilities it provides e.g. the runways and terminal.BUSINESS ACITIVITYThe Product of Manchester AirportManchester Airport is a service company. Its products are mainly thefacilities it provides e.g. the runways and terminals and also theservices it offers to its customers i.e. the airlines.The Airport Company act s as landlord and guardian of the whole site providing the infrastructure and main facilities e.g. roads, drains,phones, runways and terminals. Its income comes from the charges andcosts for using the facilities e.g. airlines pay for the runway,handling agents pay for ticket desks and shopkeepers pay rent.The Airport Company is also responsible for1 Marketing and promoting the Airport brand2 Lobbying Government and other authorities3 Environmental standards4 Ensuring a safe and efficient Airport.Products for Airlines and Tour OperatorsManchester Airport offers products and services directly to airlinesand tour operators, and in other cases acts as landlord and regulatorof services for the may private companies that make the Airportdiverse.RunwaysManchester Airport has two runways, each 3,050 meters in length.Runways need to be this length to enable aircraft of all sizes andweights to land and take off safely. They operate in segregated mode,which means one runway is used for take of fs and the other forlandings.Passenger FacilitiesIn order to process passengers through the Airport, Manchester Airportplc provides facilities such as check-in desks, baggage handlingsystems and a number of high street retail outlets.SecurityWith the exception of Hold Baggage Screening, Manchester AirportAviation Services (MAAS) is responsible for the aviation securityservice at the Airport in areas of access control, searching andscreening of passengers and baggage, and ensuring that the Airportcomplies with legislation and guidelines issued by the Department forTransport and the International Civil Aviation Organisation.Hand baggage may be checked at any time within the Airport area, aspart of the Airports visitor security policy.The US Federal Aviation Authority stipulates that all passengers onflights with US-based carries have an extra security scr... ...byThe Aviation Society and has staff of trained guides who leadeducational tours for groups of all ages, providing a structu red andinformative introduction of life at the Airport .Aviation Viewing ParkSpectacular views can also be seen from the Aviation Viewing Park,which is managed by the Bollin Valley Rangers.EducationThe variety of activities and vibrant of the Airport helps stimulateexciting ideas fir educational projects. Over the years, the Airportseducational officer has worked with many of the 3,000 schools and alarge number of collages in the immediate catchments area of greaterManchester and Cheshire, as well as others through out the north ofEngland and Wales.NHS Walk-in CentreThis is a one-stop drop in centre for travellers, other visitors tothe Airport and the local community to ask immediate health relatedquestions.Occupational health UnitThe centre provides pre-employment medicals for staff working at theAirport and CAA medicals for air crew as well as providingconfidential support and advice to employees.Petrol stationsThe Airport owns and manages two petrol stations on site, these arepar t of MAVL.

A Comparison of the Runes and Magic in Beowulf and The Saga of King Hrolf Kraki :: comparison compare contrast essays

Comparing Runes and Magic in Beowulf and The Saga of King Hrolf Kraki There are runes and thaumaturgy in the narratives of the poem Beowulf and The Saga of King Hrolf Kraki, an Iceland saga representing 1000 years of oral traditions prior to the 1300s when it was written. Beowulf is an Anglo-Saxon narrative poem whose oral traditions date back to the one-sixth century (Ward v1,ch3,s3,n11). Beowulf opens with a short account of the victorious Danish king Scyld Scefing, whose pagan transfer-burial is described. His body was carried on board a ship, piled up with arms and treasures the ship passed out to sea, whence Scyld had arrived to the Danes as an abandoned child a likely indication of a charmed, magical life. In The Saga of King Hrolf Kraki we meet Yrsa (also found in Beowulf), who is an impoverished child of uncertain birth (Byock xi) she later becomes queen another charmed life. But re,markably she grows into one of the few women in the saga who do not implement magi c. In Beowulf the reigns of Scylds son and grandson, Beowulf and Healfdene, are mentioned, and we then meet Hrothgar, the son of Healfdene. In The Saga of King Hrolf Kraki we also meet a Hrothgar, but his name is lessen into Hroar. He and his brother Helgi saw their father, King Halfdan, killinged by King Frodi, who would have killed the two sons except for the magic of the commoner Vifil with whom they were hiding. King Frodi, in his attempt to kill them, sought the aid of seeresses and soothsayers, and when that failed, of sorcerers (2). But the magic of Vifil was so strong that it obscured the supernatural vision of the women (witches?) Vifil knew that powerful spirits have visited the island where he lived (3) and thus saved Helgi and Hroar. later Hroar is a notable figure, just as in Beowulf, ruling over the northern English kingdom of Northumberland until forced into a disastrous conflict. Meanwhile, as kids, Hroar and Helgis sister, Signy, manifests an uncanny poetic abili ty of speaking in beautiful verses when Jarl Saevil is escorting a group to King Frodis celebration to me this seems magical. At Frodis feast a seeres named Heid is placed high up on a trance platform and asked to reveal any information about Hroar and Helgi.

Teens Parental Friend Essay -- essays research papers

Its okay what you do here. Im a cool mom. Thats a quote from the latest adolescent movie, Mean Girls. Most parents think that being their teens best friend is something that will help them understand why teens do what they do. Unfortunately thats not the case. Parents who give their teens whatever they want at whatever cost are wrong. They are teaching their teen to spoil their own child in the future. They also can start teaching their teen bad habits by not giving them chores to do or making them do homework. When parents become conclude friends with their teen the role of the authority figure is lost, which causes the teen to become lazy, dependent, and prevents them from succeeding to their highest performance.Parents who give their teen whatever they want at whatever cost is flub their child. Yes, we all understand that parents want to stay active and participate in their teens life. If a parent spoils his teen with new clothes, shoes, video games, and capital that gives the teen the impression that its okay to ask for whatever they want, in reality thats not possible. The teens have to work for what he wants. In a research 40 percent of parents said that they would buy their child everything they wanted if they could (USA Today). Sampson Lee Blair said, Trying to play to every little whim or longing will create problems for the child later in life. I have to agree. A parent can still be his teens friend, barely in a different way, a par...

Commentary On The Road Not Tak :: essays research papers

The verse is basically about a person who has at some point in his smell been posed with a question of which path to take. Obviously, there would be a dilemma on his part and the poem revolves around his decision. freezings narrative style has lent itself to a certain amount of ambiguity in what he is trying to convey.This ambiguity that ice has left the reader to contemplate is basically divided into two schools of thought. The first is that Frost has a regret for the plectrum that he has made and he is relating the hardships of that choice to the reader. The alternative is that he is simply trying to make a statement about life and harbors no regret towards the choice that he has made.The first beginning to be considered is that of Frosts analogy of ones life being put onto some sort of timeline and he has used roads to illustrate the idea of many possibilities. The use of nature in the same line Two roads diverged in a yellow wood gives an almost organic-like appeal. This helps us to integrate roads into the natural environment and it gives an impression that the decisions that we have to make are natural. The divergence of the two roads into the same place (a yellow wood) symbolises Frosts departure into the real world (because of the singularity in wood). This could mean that the wood is being compared to the unknown world. Again, in the first stanza there is the cancel of the ambiguity in the very colour of the wood. A strong believer in the view that Frost has given a high-risk tone to the poem will point out that there is a significance in the very colour of the wood. This is because yellow represents autumn time where the stigma is that everything around him is last and because of life he still has to continue. Furthermore, there is the inclusion of the second line And sorry I could not travel both. This could mean that he is regretful because he will never know what the other path offered. On the other hand it could also be interpreted that it is plain curiosity which has take him to say this, not any regret for what he has failed to do. Frost has used a clever illustration of the continuance of these roads to depict the uncertainty that life holds.

Commentary On The Road Not Tak :: essays research papers

The verse is basically about a person who has at some point in his biography been posed with a question of which path to take. Obviously, there would be a dilemma on his part and the poesy revolves around his decision. hoars narrative style has lent itself to a certain amount of ambiguity in what he is trying to convey.This ambiguity that rime has left the reader to contemplate is basically divided into two schools of thought. The first is that Frost has a regret for the excerpt that he has made and he is relating the hardships of that choice to the reader. The alternative is that he is simply trying to make a statement about life and harbors no regret towards the choice that he has made.The first nucleotide to be considered is that of Frosts analogy of ones life being put onto some sort of timeline and he has used roads to gild the idea of many possibilities. The use of nature in the same line Two roads diverged in a yellow wood gives an almost organic-like appeal. This hel ps us to integrate roads into the natural environment and it gives an impression that the decisions that we have to make are natural. The divergence of the two roads into the same place (a yellow wood) symbolises Frosts departure into the real world (because of the singularity in wood). This could mean that the wood is being compared to the unknown world. Again, in the first stanza there is the galvanise of the ambiguity in the very colour of the wood. A strong believer in the view that Frost has given a lamentable tone to the poem will point out that there is a significance in the very colour of the wood. This is because yellow represents autumn time where the stigma is that everything around him is dying and because of life he still has to continue. Furthermore, there is the inclusion of the second line And sorry I could not travel both. This could mean that he is regretful because he will never know what the other path offered. On the other hand it could also be interpreted th at it is plain curiosity which has guide him to say this, not any regret for what he has failed to do. Frost has used a clever illustration of the continuance of these roads to depict the uncertainty that life holds.

Contribution in Religious Essay

Shh Walullh was natural in 1703, four years before the demise of Mughal emperor moth Aurangzeb. His genealogy can be traced back to the family of Umar ibn al-Khattab. He received a structured education and unearthly instruction at the madrasa ( unearthly school) schematic by his suffer, Shah Abd al-Rahim, at Delhi. Along with the Quran, he studied Arabic and Persian grammar and literature and the higher philosophical, theological, metaphysical, mystical and juridical texts. He graduated from the school when he was barely fifteen years old in the homogeneous year, his father initiated him into the illustrious Naqshbandi order. He began his career as a teacher at the Madrasa-e-Rahimia infra the tutelage of his father after the death of the latter in 1719,Shah Waliullah became the head of the madrasa, teaching all the current sciences at the school for about twelve years. During the same period he continued his own studies, growing in stature as a teacher and at packageing stude nts to his circle. In 1731 he went to the Hijaz on a pilgrims journey (Hajj) and blocked there for fourteen months studying Hadith and Fiqh under such distinguished scholars as Abu Tahir al-Kurdi al-Madani, Wafd Allah al-Makki, and Taj al-Din al-Qali. During this period he came into contact with people from all parts of the Moslem world and, thus, obtained first-hand information about the conditions then prevailing in the various Muslim countries. During this time, he in addition saw the forty-seven spiritual visions which form the guinea pig matter of his far-famed mystical work Fuyud al-haramayn (Emanations or Spiritual Visions of Mecca and Medina).He returned to Delhi in 1733, where he washed-out the rest of his deportment in producing numerous kit and boodle till his death in 1763 during the reign of Shah Alam II. The most important of Shah Waliullahs works is his ujjat Allh al-Bligha in which he made an attempt to evince the teachings of Islam in a spirit of scientifi c objectivity. The range of his works include economic, political, social, meta-physical, as well as purely theological aspects. Shah Waliullah married twice in his lifetime, first when he was 14 years old. He had a son and a daughter from his first marriage. He concluded the second marriage past after his return to India. He had four sons and a daughter from his second marriage. His historically significant contribution is that, when Marathas were expanding their knowledge domain of control towards the Northwest of India, Shah Waliullah and some distinguishable Muslim leaders of India kept writing earn to Ahmad Shah Durrani,the Muslim ruler of Afghanistan, to keep him informed of the developments in India. Ahmad Shah Durrani was finally persuaded to return to India to confront the Marathas. Consequently, in 1761, in the decisive Battle of Panipat, Marathas were defeated by Ahmad Shah Durrani and his allied forces.Al-Irshad ila-Muhimmat-I-Ilm-al-Isnad (Arabic)- is about the sch olars of Hejaz who taught Shah Waliullah. Izalat al-Khafa an Khilafat al- Khulfa (Persian) Al-Fauzul Kabir Fi Usoolu-Tafseer (Arabics) Atayyab al-naghm fi Madh-I-Saiyid al- Arab wal-Ajam (Arabic)- A collection of odes eulogizing the dedicated Prophet which speak of Shahs poetic talent and whap towards Prophet. Altaf al-Quds (Persian) Deals with esoteric principles of mysticism. Al-Imdad-o-fi Maathir al-Ajdad (Persian)- A brochure giving Shah Waliullahs genealogical table and containing brief nonices about some of his ancestors. Al-Intibah-o-fi Salasil-il-Aulia Allah (Persian)- Gives the history and brief introduction of different mystic orders. Insan al-ain fiMashikh al-Haeamyn (Persian) Al insaf-o-fi Bayan-I-Asbab al-Ikhtalaf (Arabic) Anfas aal Arifin (Persian) Al-Budur al-Bazigha (Arabic)- This work on theology employs philosophical terminology in discussing human nature and social behavior.Bawariq al-Wi identifyah (Persian)- The tract forms part of the Anfas al-Arifin in whic h the Shah has draw the life and spiritual attainments of his father Shah Abdur Rahim. Tawil al-ahadith (Arabic)- It recount the stories of different prophets mentioned in the rule book in order to draw out lessons and rules of Shariah from the account bookic describtion. Tuhfatul Muwahhidin- It is a Persian tract explaining the creed of tauhid. Tarajim-o-Abwab al-Bukhari (Arabic)- It expounds the principles which would be found helpful in understanding certain difficult portions of the Bukhari. At-Tafhimat al-Ilahiyah (Arabic and Persian)- Its a mystical work, part in Arabic and partly in Persian, giving the mystical experiences of Shah. Al-Juz al-Latif fi- Tarjumata al-Abd al- Dhayif(Persian) Hujjat Allah al-Baligha (Arabic)- The magnum opus of Shah has been discussed in the seventh section of this work. Husn al- Aqidah (Arabic)- The fundamental creed of Islam as accepted by the Ahli-I-Sunnat sect, has been expounded in this work in the light of Quran and Hadith. Al-Khair al-K athir(Arabic)- This work on philosophy of religion elucidates the concept of marifat and wisdom of Divine Names, revelation etc. Ad-durrus Thamain fi-Mubashshiratil Nabi al-Amin (Arabic)- It is a collection of cheery tidings the Shah and his ancestors had had from the holy Prophet. Diwan-o-Ashar (Arabic)- A collection of the Arabic verses of the Shah. Risalah- was written in reply to certain mystical issues raised by Shaikh Abdullah bin Abdul Baqi. Risalah Danishmandi (Persian) A of import tract containing detailed directions in regard to regularityology of teaching. Zahra federal agencyn- A commentary on the Surat-ul-Baqarah and Imran. Surur al- Mahzun (Persia)- It is a concise Persian rendering of the Kitab Nur al-Uyun il-Amin al-Mamun a well-known sprightliness of the holy Prophet. Sharh-o-Tarajim-I-Abwab-I-Sahih al-Bukhari (Arabic)- is an annotation on certain chapters of the Sahih of Bukhari. Shifa al-Qulub (Persian)- is a tract of mysticism. Shawariq al-Marifat (Persian)- a biography of the Shahs Uncle Shaikh Abdul Raza. Al-Atiyatus Samadiyah Fi Anfas Al-Muhammadiyah (Persian)- this small brochure contains a biographical sketch of the Shahs maternal grandfather Shaikh Muhammad Phulti. Iqd Al-Jid Fi-Aakham Al-Ijtihad Wat-Tajdid (Arabic) Fath-ur-Rahman(Persian)-a translation of the Quran. Fath-al-Kabir (Arabic)- A glossary of the intricate words of the Quran.In the 18th century, Islam in the Sub-continent was faced with menacing problems. Sectarian conflict, low honorable tone of the society, poor understanding of the Holy Quran, and general ignorance of Islam were just some of the issues which gave rise to fear that political collapse would be accompanied by religious disintegration. This did not happen rather an era of religious regeneration was inaugurated, which was due more than than anything else to the activities of one man, Shah Wali Ullah.Early ages of Shah wali UllahShah Waliullah was born in the 21st of February. 1703 CE, in the townspeopl e of Phulat in Muzaffarnagar, Uttar Pradesh, India. His father, Shah Abdur Rahman was a great scholar and a mystic. he named his boy Qutubuddin Ahmad. The name Shah Waliullah is given to him by people because Waliulla means close to God. So his complete name was Shah Waliullah Qutubuddin Ahmad.Education & TrainingHis father took special pain in the education and the training of his son. Shah Waliullah was introduced to Moslem education at the age of louver and completed the recitation of the Quraan by the age of sevenAt the special age of 15, Hazrat Shah Waliullah had completed his education and then became a disciple (mureed) of his father who gave him spiritual training. When he was 17, his father died, for 12 years he taught in the fashion of his father.Pilgrimage to MakkahIn 1143 H.E. the 23 year old Shah Waliullah decided to perform the pilgrimage to Makkah. Despite the perils(Dangerous Journey) that lay on the journey he reached the Mecca on 14 Dhul Qadha 1143 H.E. and perfo rmed the Hajj and then proceeded to Medina. There, he attended the discourses on Sahih Al Bukhari from Sheikh Abu Tahir Muhammad Bin Ibraheem Kurdi Madani. The Sheikh say him in the study of the six Sahihs (Bukhari, Muslim, Tirmidhi, Abu Dawood, Nasaai, Ibn Maajah), He returned to Makkah, performed the hajj again and learned the Muwatta Imam Maalik from Sheikh Wafadullah Maliki Makki, attended the discourses on Sahih Al Bukhari from Sheikh Tajuddin Hanafi Qalaei Makki for a few days and learned the six Sahihs from him. He was granted permission to teach all the books of hadith by Sheikh Tajuddin.After 14 months of stay in Arabia, two hajj pilgrimages and learning the books of hadith from the scholars of the holy cities, Shah Waliullah finally returned to India in early 1145 H.E. the journey home lasted six months and he reached Delhi on Friday 14 Rajab 1145 H.E. on reaching home, he started teaching again and writing until his death three decades later.ORTwice he performed the Hajj pilgrimage. He attained a certificate of Proficiency in Hadith from the famous scholar, Shaikh Abu Tahir Bin Ibrahim of Madina, when he was in Arabia, the marhatta turmoid was at its height and his friends advised Hazrat Shah Waliullah to stay in Arabia. As such he left Arabia in 1145 AH and reached Delhi on 14 Rajab 1145 AH.Work of Shah Wali UllahOn reaching Delhi, he devoted most of his time in writing books and to discourse in public meetings. The teaching activity was limited to the lessons of Hadith. The political and the moral degeneration of the Muslims had tremendous effects on the sensitive thinking mind of Hazrat Shah Waliullah. His famous book Al-Tafheematul llahia minutely pen points all the various defects, shortcomings and vices, which had taken roots in various sections of the Muslims. His aim, metaphorically speaking, was to destroy the rotten moral buildings and to reconstruct a new mansion over it. He bluntly wrote in one of his writings I have arrived to destroy every old in domain at present.Quran Translation into PersiAN LANGUAGEThe most monumental labour he performed was to translate the Quran from Arabic to Persian which was the language talk by the Muslims at that time in India. His aim was that educated Muslims may have access to the Quran without depending on the scholars who had opposed his reformatory measures. The short comprehend ullama gathered and wanted to kill him for his sin of translating the Quran from Arabic to Persian but he continued with his task till he completed it. This task was appreciated by Allah so much so that the Quran is translated to numerous languages.Hujatul Baligdh (Popular Book)Apart from the Holy Quran, Shah Waliullah also wrote authentic books on Hadith, the principles of Hadith, Tafseer and on mystical subjects. except the most popular book of Hujatul Baligdh. This book explains how Islam was found suitable for all races, cultures and people of the world and how successfully it solves social, mor al, economic and political problems of human beings.Al Fauzul Kabeer bung Usool.Al Fauzul Kabeer Fee Usool at Tafseer, a booklet in Persian that follows his Persian translation of the Quran. It contains the nucleus of the Quran, the rules for interpretation, and interpretations of the Quran by other famous scholarsAnalyzing his political thought, Iqbal statesThe Prophetic method of teaching, according to Shah Waliullah is that, generally speaking, the law revealed by a prophet takes especial notice of the habits, ways and peculiarities of the people to whom he is specifically sent. The Prophet who aims at comprehensive principles, however, can neither reveal different peoples nor leave them to work out their own rules of conduct. His method is to train one particular people and to use it as a nucleus for the build up of a universal Shariah. In doing so, heaccentuates the principles underlying the social life of all mankind and applies them to concrete cases in the light of the spe cific habits of the people immediately before him. (Reconstruction of Religious Thought in Islam)Letters By Shah Wali UllahHe wrote open letters to Mughal rulers, to give up their corrupt and inefficient practices. Soldiers, for forgetting to inculcate within themselves the spirit of Jihad. Artisans, workers and peasants, reminded them that on their labors the economic prosperity of the state depends. The Emperor, to teach a lesson to the Jats threatening the Mughal pudding stone and also wrote to him not to give jagirs to mansabdars, who were not loyal to the state. Masses, to be conscious of their duties and not to indulge in the accumulation of wealth.He wrote to Ahmad Shah Abdali to give up the life of ease, draw the sword and not to sheath it till the distinction is established between true faith and infidelity. His efforts resulted in Maratha debacle at the hands of Ahmad Shah Abdali and Najibud Daula in the third battle of Panipat in 1761 A.D.The times of Shah WaliullahShah Waliullah lived during the times that can best be described as disastrous for the mughal dynasty in India. The descendants of the Mughal emperor Aurangzeb are alleged to have squandered the wealth amassed by their forefathers on entertainment, dance, music and wasteful constructions. The Shiites exercised significant influence on the court. The kingdom wasreeling under the loathsome spells of droughts, poverty, hunger, hopelessness and purported indifference and cruelty at the hands of their rulers. The character of the people were alleged to have fallen to the lowest levels of civilised behavior.According to Hazrath Salman NadwiThe sway of the Moghal pudding stone was only namesake, Muslims were engulfed in wrongful and unnecessary traditions, frauds and scoundrels had kidnapped the graves of the pious and became their custodians, the seminaries were disputing on the topics of philosophy and wisdom, religious edicts were being literally interpreted by jurists. Leave unsocial the common men even scholars were ignorant of the meanings and teachings of the Quraan, hadith and theologyService to MankindAfter returning from Mecca and Medina, the miserable condition of Indian Muslims inspired him to cleanse their character, buck up their morale, inculcate the feeling of selflessness and love for their fellows. He overhauled the existing education system, separated the faith from unlawful invented traditions (bidaat), unnecessary and unwanted suspicions regarding Islam and its holy books. He presented what he considered pure and pristine Islam to the peopleDeath of Shah SahabHe died in Delhi on the year 1176 AH corresponding to 1762 AD, behind the central jail. There is a vast ground and a graveyard known popularly as Mehindin Kakhitta which contains in it the grave of Shah Waliullah and his progenyHis Final WillThe final will of this pocket-size servant of Allah is that always hold tightly to the Quraan and Sunnath in your beliefs and acts. Regularly evaluate y ourself against them. Read them regularly and if you cant, thenfind someone who can and find out to at least a couple of pages everydayChildren of Shah Wali UllahShah Abdul AzizHazrat Shah Waliullah was fortunate of having children who were great scholars and god-fearing men like himself. His eldest son Shah Abdul Aziz was born in 1159 AH and died in 1238 AH corresponding to 1823 AD. At the age of 17 he had become an accomplished scholar and began teaching like his father. For 60 years, he continued teaching and prophesy Islam. The blessing of his knowledge reached every corner of the Indian sub-continent. Because of his versatile genius he was giving the title Ayatullah, a sign of God.Rafi-uddinThe second of Shah Waliullah Rafi-uddin. He was born in 1163 AH and died in 1233 AH. His scholarly qualities may well be judged from the fact that when Shah Abdul Aziz had become to teach he passed on his responsibilities to Shah Rafi. Among the work of Shah Rafi his urdu translation of th e Holy QuranShah Abdul QadirThe third son of Shah Sahib was Shah Abdul Qadir who was born in 1162 AH and died in 1230 AH. He was also a big scholar by his nature, he loved solitude, and he washed-out his whole life in a secluded room of Akbar Badi mosque. He did not much attend to literary writings, however, his urdu translation under the title of Mozih ul Quran was his monumental achievement which is recognised by scholarly circles.Abdul GhaniHis fourth son was Abdul Ghani. He was a saintly person. His son Shah Ismail Shaheed was a unique personality who had feature in himself all virtues ofscholarly and mystical personalities.ConclusionIn short, due to sincere and dedicated efforts of Shah Waliullah and his family the illustrious banner of Islam kept flying over the Indian sub continent despite the decline and fall of the Mughal empire. In Spain, the faith of Islam disappeared with disappearance of the Muslim rule. Many Muslims were killed and many were converted to Christianity . In India however the excogitation of the British Government did not realize and Muslim India did not convert to the faith of the ruling people despite missionary efforts of the British Government who spent millions of pounds on missionary activities and arranged lectures, debates and seminars to propagate their faith. The failure of the British Government in converting Muslim India was due to the dedicated efforts of Hazrat Shah Waliullah and his noble family.Shah Wali UllahBiographical DetailsShah paries Ullah was born on 21 February 1703 during reign of Emperor Aurangzeb Alamgir. His real name was Qutub-ud-Din, but he later became known Shah Wali Ullah because of his piety. His father was Shah Abdul Rahim, who founded the Madrassa Rahimiya in Delhi. When his father died in 1718 Shah Wali Ullah began teaching at the Madrassa.In 1724 Shah Wali Ullah went to Saudi Arabia to perform Haj and to further his studies. He studied under the famous Sheikh Abu Tahir bin Ibrahim,before ret urning to Delhi in 1732.BeliefsDuring his time in Saudi Arabia, Shah Wali Ullah thought plenteously about the problems faced by Muslims in the Mughal Empire. The Empire was in decline and Muslims were disunited and vulnerable to attacks on their religion. ShahWall Ullah realised that reform could not come from the weak leadership in Delhi and that it had to come from within the Muslim community itself.He believed that many of the problems of the Muslims resulted from their fractional knowledge of Quran and about Islam in general and that what was needed was for Quranic teachings to become more accessible to the people.A major problem for the Muslim community was the way that it was divided into sectarian groups, such as Sunnis and Shias. Shah Wall Ullah wanted them to concentrate on the fundamental principles of Islam and put aside their differences, believing that this would create a more united community.It was essential to follow the moral and spiritual principles of Islam in order to create a good society. Un-Islamic principles were not pleasing in any area of society, whether politics, economic science or just the day-to-day lives of the individual Muslims.Work-Shah Wall Ullah worked hard to ensure that he was a role model for other Muslims. His deep understanding of the Quran, Hadith, Fiqah and Tasawuf made him a highly knowledgeable scholar at an early age.-Since he believed that an emphasis on Quranic teachings was vital to Muslims, he translated the Quran into Persian. few Muslims spoke Arabic and so the Quran had not been widely studied previously. Now it could be understood by a larger number of Muslims. The ulema criticised Shah Wall Ullah, but his work proved very popular. Later his two sons, Shah Abdul Qader and Shah Rafi, translated the Quran into Urdu, which meant that many more people could study it.-In addition to translating the Quran, Shah Wall Ullah wrote 51 books. He wrote in both Persian and Arabic. Amongst the most famous were Huj jatullah-ul-Baligha and Izalat-Akhfa. He also wrote an account of the first four caliphs of Islam in a way that was acceptable to both Shias andSunnis. He hoped that this would help to heal the division between them. His writings brought him great fame and prestige and enabled him to have influence in other areas too. For example, in economics he emphasized the need for social justice and for peasants and craftsmen to be truly valued for their contribution to the economy.-One of Shah Wali Ullahs most important contributions to the Muslim community was his organic law of impedance to the Marathas, who were threatening to over-run the Mughal Empire from the south. He realised that the Muslims had to unite to deal with this threat, and that of the Sikhs who were attacking in the north. Shah Wall Ullah wrote to all the Muslim nobles calling on them to total together to save the Mughal Empire. It was partly his influence which helped to persuade Ahmed Shah Abdall of Persia to interven e. He joined forces with local Muslim leaders and defeated the Marathas at the Battle of Panipat in 1761. However, despite encouragement from Shah Wall Ullah, the Muslim leaders did not unite to take advantage of the defeat of the Marathas. Perhaps if they had done so, the Muslims would not have currently found themselves under non-Muslim rule.ImportanceShah Wall Ullahs contribution towards Islamic revival was extremely important for a number of reasons-He was one of the first Muslim thinkers to state that the decline of the Mughal Empire and the vulnerable position of the Muslims were due to neglect of the principles of Islam. He believed that if the decline in the position of the Muslims was to be stopped, there had to be spiritual and moral regeneration.-He showed how this regeneration might take place. The Madrassa Rahimiya continued to play a vital role in teaching Islamic principles and researching Islamic thought.-His writing in Persian made Islamic teaching available to lar ge numbers of Muslims who had not been able to understand Arabic. He believed that Muslims could only prosper if they followed proper Islamic customs and did not indulge in social evils. Shah Wali Ullah provided the inspiration for Muslims to lead a pure life, based on a belief that anti-social attitudes incurred the displeasure of God.-He also showed that a Muslim revival could only take place if there was an acceptance that sectarian division was to stop. Muslims had to concentrate more on the basic principles of Islam, and not allow the differences between them to lead to conflict.He tried to build bridges between the different Muslim sects and to unite the community. He tried to do this by organising opposition to the Marathas and uniting Muslims by emphasising the importance of Jihad against a common enemy.-He trained his sons to continue his work and had such a huge following that his work remained famous for many generations. Like all great reformers, Shah Wali Ullahs influen ce continued long after his death. Not only did his writings survive and translated in many languages, but the Madrassa Rahimaya continued to flourish. Many future Islamic leaders were inspired by him to fight for the good of the Muslim community.

The Major Stages of A hero’s Journey in Hawthorne’s My Kinsman, Major Molineux

The story is about a young mans search for a man that he and his father thought could help him to have a good fortune Major Molineux, cousin of the boys father. However, in the end, after totally that he went through, he was dismayed, yet a nonher friend encouraged him to stay in the city and see if he could understand a fortune without the help of his kinsman. The story opens with a description of the prison term when the story took place. This is perhaps important as in epics which seek the reference of the events in the narrative.Here, the introduction hurls the readers a clue regarding the conviction and place, thereby creating a good background for the readers to understand the story even if the reader is from a distant time or place (Hawthorne and Harding 37). It is in the second paragraph where Hawthorne starts the narration of robins quest. Hawthorne describes the scene thus, It was near nine oclock of a moonlight evening, when a gravy boat crossed the ferry with a si ngle passenger (Hawthorne and Harding 37). This is already the initiation stage of the journey. Together with the description of his clothes that were made to last (coarse shirt, leather boots, and so on , it was obvious that he was in for long journey. He looked the place, clueless of the place where his kinsman could be. So he is left to the last resort of asking for directions from raft he would meet on the way (Hawthorne and Harding 38). It can be noted that he asked for help several times, unless he found n 1, except in the later on destiny of the story when he forced an old man and an new(prenominal) person volunteered to stay with him to wait for his kinsman. The separation is described in later paragraphs as a flashback through a narrative from the hero Robin.The separation stage tells us that he and his family had high hopes (Hawthorne and Harding 56). His brother took his placer in plowing the fields and his give sew for him his clothes, hoping for the best that he could have. This is a very timely part in the story to narrate, because it brings the reason of the journey closer to the dismay that was about to moot place, which was to evoke the heros return as a failure. It could have been a failure. In fact, he asked his friend twice to lead him back to the ferry, scarce the return was delayed by an optimistic invitation to stay longer (Hawthorne and Harding 56).The story ends there, but from the hints that he was a shrewd youth (Hawthorne and Harding 56), we can guess that with way from his new friend, he could have a good sprightliness in the city and return to his home with success to talk about. Why one should select Thoreaus Walden Walden is not a novel or an epic. It was not considered a masterpiece during his time. In fact, his mentor, Ralph Waldo Emerson was disappointed with it (Alsen 242). Indeed, few of his contemporaries would have presumed that Walden would be hardened with as much importance as it is being treated now in Li terature.But what is it in Walden that makes it a must to read for anyone studying Literature, school of thought and American culture? First, we can note that it is a product of a mans solitude. Thoreau wrote it in deep solitude, that his ideas must have flowed with enthusiasm. As he was a literary genius, a work he wrote in such a state is worth reading. Take for example, the narratives he wrote in Walden about the struggle of ants. In the recount, he extensively described what happens in a combat between red and black ants (Thoreau 162).This recount is worth a students time because the scenes depicted are not everyday scenes one can see in the city or even in the gardens or woods. He made apostrophes in reference to Homers Iliad, which now shows a style that is worth emulating. The learning one can get from this short part of the book is difficult to find, unless one would spend his time patiently in the woods like Thoreau did. To consider things more, many of the things Thoreau wrote, he learned serendipitously. Hence, even if one would spend time like he did, there is no assurance he could come across the same encounters.In all these, his work teaches the jr. generations to have respect for life, for nature. The Battle of the Ants is a classic example of primitive life lived by other creatures that co-exist with us in the woods, in gardens and in ponds (Thoreau 162). alike(p) us, they struggle for life and power, so we ought to co-exist with them rather than kill them. Romanticism in Hawthorne and Thoreau Hawthornes My Kinsman, Major Molineux and Thoreaus Walden are two very different genres of literature, but they share elements of romanticism. First, I will define romanticism based on what experts say.Romanticism, according to Peckham in Adams is to have the goal of originating from something that has never existed before (Adams 2). It is therefore not the adherence to existing standards, but the creation of beautiful things based on ones own standard s of beauty and wisdom. So, starting with Walden, we can see the aim of romanticism. It was written not in the form any literary piece has been written before. He wrote based on a keen observation with no conscious consideration of any standards in writing during his time, thus many of his contemporaries did not like his work primarily because it was odd.Hawthornes story, on the other hand presents a different kind of plot. In most stories that we know, a hero leaves his home and promises to come home with victory. Usually, the hero fulfils his mission. Not Hawthornes Robin. Robin went through the stages of a heros journey, but he did not get what he initially wanted. He did not get help from the people he expected would help him and when he found the person he was looking for, he decided to go home in dismay.But life had to go on for him, so instead of going home, he would surely stay awhile and see what the city had in store for a boy as shrewd as he. This makes the story more us eful than those with happy endings, for it teaches a reality about life one does not get all that he wants right away. The romantic element that the two works shared was the novelty of their ideas and concepts. The authors did not adhere to conventions, but created their masterpieces based on what they thought would be beautiful or useful. transcendentalism in Walden and Self-Reliance Both authors, Thoreau and Emerson, being mentor and student to one another must have had similar philosophies. And indeed, Thoreau is a believer of Emersons concept on self-reliance. The term self-reliance itself points out to another philosophical belief during their time transcendentalism. Transcendentalism is a reaction against scientific rationalism, thereby teaching that intuition is the only way to understand reality in a world where every natural fact embodies a unearthly truth (Emerson 205).Hence, Transcendentalists discount external authority and tradition and depend on firsthand experienc e. So, the motto is Trust Thyself (Emerson and Carlyle 47). So how Walden and Self-Reliance live up to Transcendentalism? First, it should be noted that Thoreaus work was written largely based on his experience in Walden Pond. Next, the ideas put forward by Thoreau in Chapter 1, genius is as well adapted to our weakness as to our strength (Thoreau 6). This definitely reflects two things one, learning based on his experience at the pond second, the doctrine of trusting oneself, because one is provided with what he needs to survive if he will just work to get it. Walden actually echoes the teachings of Emerson Self-Reliance, where his mentor attacked those who believed in luck or fortune (Emerson and Carlyle 54)) Emerson points out that what we see as luck is actually a result ones persistence, so when the opportune moment comes, the one who did not waste time would be ready to seize the moment.This leads to an extension of Transcendentalist ideas. Trusting oneself does not mean bei ng arrogant, but using ones time efficiently. It does not mean disregarding religion, for there is one Great Soul above everyone. But as that Great Soul is just, He will give success to those that deserve it, because they worked for it.

Philosophy of the movie Big Fish Essay

The philosophical twist of mixing fact with fairy tale in story promulgateing put a great twisting on the plot. It gave the director the ability to make the impossible seem probable The movie is about a very interesting father named Ed whom loves to tell facts with a little bit of flavor, as quoted in the movie. However we portray them as tall tales, but since he tells them with such a seriousness and supplement to his own life you want to believe them. However the son, will, does not enjoy these stories. He believes they be all lies which create a detachment between him and his father. alone as the movie goes on, the real question for will to discover is, are all these stories really fake. Inspired by the scientific phenomena of a gold fish growing in accordance to the size of its surroundings, Ed applies this theory to his life and embarks on a journey to satisfy his ambition In this journey we take care Ed convincing a giant to leave town and be partner in discovering life, finding a hidden town that had lush mass for streets, catching a fish with his wedding ring, or viewing his final hours in the eyes of a witch.The stories in this movie are steady-going examples of improbable stories with poetic truths. For example in the story of the fish, we learn that to catch the uncatchable women you have to give her a ring The movie does a great crinkle of blurring fact with fiction. For instance, if we were to view the stories in this movie as real life, how would we react? In my opinion with my realist mentality, I would look at these stories and believe they are complete nonsenseBut, if I took a step back and try to look at the stories with the most objective mind I can, the possibilities of these stories actually mishap seem more probable. Use the story of the witch and her futuristic eyeball. There is a spiritual realm that is all around us. Is it crazy to think that almost woman could have been in touch with, lets say evil spirits, which gives her t he power to scare people with visions? Or is it really impossible for a man to catch a fish with a shiny object?Or is it really impossible for a town to be self-sufficient, maintain full-blooded grass, and not build any streets? I would like to think so So with that being said, the concept of there not being much of a distinction between fact and fiction would be true As the movie concludes we find out, just like will, that these stories are in fact true. When result attends his fathers funeral he sees the Giant, the Siamese twins, Winslow the poet, and many more of the story charactersHowever all of the character appeared different in real life compared to the flavourful Facts. Nonetheless, this confirmed his fathers stories showing the small distinction between fact and fiction It is at this time Wills eyes are opened and it gives him the ability to see poetic truths behind the stories. In the end we hear wills son telling friends one of Eds stories, and Will concludes with thi s phrase, A man tells his stories so many times that he becomes his storiesthey live on after him and in that way he becomes immortal.

Business ethics and CSR

In the past time, the majority of enterprises regarded chore moralistics as internal regulations to agree with the rules of legal standards(Trevino and Nelson, 2010). However, the condition changes in modern times. Business honourable motive is more than and more important to identify what it is right or amiss(p) during the process of working or trading and so on(Wheelen and Hunger, 2011), which is closely related to the interests of stakeholders.Under the background, many companies recognize that they assimilate to obtain more respect and trust of their consumers so as to be successful. As result, organizations dedicate change magnitude oversight to their behaviors and incorporated complaisant responsibility (CSR) become a crinkle principle for marketing behaviors with the change magnitude public awareness ab aside the role of enterprises in assisting to promote and practice business morality in society and environment.In order to have a relegate understanding of b usiness morals and CSR, this give notice (of) is going to logically identify business ethics and critically assessing its effect on an organization, identifying CSR and analyzing the lessons of the intelligence operation union grease and the importance of CSR and indeed discussing the lead during the process of promoting business ethics and CSR. Question 1 identifying business ethics and critically evaluating its effect on an organization 1. 1Identifying business ethicsCase and smith (2012) commented that free market system cannot guarantee the efficiency, and an efficient free market economic system need enterprises with honesty, integrity, fairness, justice and other ethics to lam the market in addition to a valid property right and the legal system. The comment perfectly demonstrates the necessity and importance of business ethics in market, although it does not make enough introductions about the features of ethics. In their opinion, business ethics refers to incorru pt principles which are used to regulate the behaviors of a business.In other words, Case and Smith admitted that the same rules or regulations that distinguish the right or wrong of individual behaviors can as well be applied to enterprises. This point explains the focus of business ethics, which promotes corporations to pay more attention to the use of copyright, environmental do its and bribery. However, Case and Smith just cared about the enterprise itself and did not make an explanation about the relationship betwixt corporations and stakeholders in the concept of business ethics.According to Lusch and Webster (2010), every go with is not alone, and stakeholder analysis is important for the practices of business ethics during the process of operation and provides more useful selective information for perfecting business ethics in different markets. They considered that enterprises depend on employees, government, media, customers and business clients and so on (Lusch and Webster, 2010), so business ethics aims at working out a balance among all those factors and then making them serves corporate objectives.It can be said that Lusch and Webster explained the affecting factors of business ethics and put forward a broader illustration, which is salutary for corporations to regulate ethically in all aspects. But this report agrees that it is better to combine the views of Case and Lusch et al. as to the illustration of business ethics. From this point of view, this report considers business ethics is a moral principle to deal with the relationship among stakeholders. According to the above literature review, it is obvious that business ethics focuses on the moral standards of corporate policies and behaviors and the effect on stakeholders.It can be said the most significant points of business ethics refer to identifying reasonable business actions, balancing stakeholder interests, increasing corporate values and building accountability within the organ ization. From this point of view, business ethics is a performance of applied ethics in essence. 1. 2 critically evaluating the effect of business ethics on an organization Business ethics is regarded as an important factor that affecting corporate performance, so it is necessary to value its entrance on an organization.But it necessitate to be pointed out that business ethics also has positive and negative effect(Carroll and Shabana, 2010). On the first place, business ethics is beneficial for organizations to build distinct competence(Pearce and Doh, 2012). For example, as the hotel industry giant, the Hilton has developed rapidly since its inception in 1928 and its branch offices are spread all over the world(Hill, 2011). On the issue of the development of the Hilton, it is inevitable to mention the hotels internal culture and requirements Today are you smiling yet?Hilton Hotel strongly embodies the customer is God and kinsfolk away from home principle in facilities and servic es, internal culture and good business ethics make customers experience the home, which win the majority of customers meanwhile the hotel becomes more rivalrous and corporate profits grow year after year. On the second place, it can protect the interests of stakeholders(Orts and Strudler, 2009). Business ethics, as a corporate soft power, reflects in all aspects of business, especially in the quality of products and services quality.According to the Haier Groups success and Sanlu milk powder incident(Bouee, 2010), lack of business ethics hurts stakeholders and corporate brand value is also enormously impacted. On the third place, good application to business ethics increases corporate scores to explore foreign market(Kolk and Van Tulder, 2010). In modern times, business ethics has become one of the most important parts for international business. In other words, the international market needs ethical companies. From this point of view, unsaturated international market gives priori ty to enterprises that have a good record for business ethics.Just as Haier, it tried its best to protect the interests of customers and then it was favored by the international market. In addition, business ethics is beneficial to invite the behaviors and words of leaders and then cultivate ethical leadership owing to the formation of a good working environment. However, there are also some negative influences for business ethics. For one thing, business ethics puts forward a in high spirits claim for corporate capability(Carroll and Shabana, 2010). On one hand, the application of business ethics needs the support of adequate capitals.In the short-term, business ethics may increase the total equal of organizations. On the other hand, business ethics can be different in different countries, so the organization needs excellent adaptability. For another, business ethic may bring about capital risks for companies that have weak financial basis(Skouloudis et al. , 2010). The applica tion to business ethic needs adequate financial support, so the ethics may threaten the operations of businesses when the corporate is lack of capitals.Question 2 analyzing the lessons of the give-and-take Corporation crap and the importance of CSR 2.1 analyzing the lessons of the News Corporation scandal The News Corporation is one of the worlds largest media groups, and one of the worlds largest and most international integrated media companies(Yoon, 2013). On July 15, 2011, the British Daily Mirror quoted the news of an anonymous New York practice of law officer, and said News Corp. s World News reporter tried to bride their telephone information of 9. 11 victims and tap their voicemail(Lewis, 2012). Facing strong public pressure, the News Corp was forced to shut down News of the World.In order to grab the exclusive news, the News Corp took a lot of extraordinary measures and then lost more. The News Corporation scandal brings about many lessons for corporate management. In th e first place, it is necessary to establish media self-regulation and professional ethics to further strengthen the social responsibility and professionalism. Wiretapping scandal stems from interests and competition-driven within the Western media(Simons, 2013), in order to expand distribution and increase influence, they even broken professional ethics and social moral bottom line.As a result, they would pay their actions. In the second place, corporates should behave within laws and ethical regulations. The eavesdropping behavior of World News not only violates the self-regulatory codes of British newspaper industry, but also unmingledly breaks down the law and human rights. It is crazy to pursuit irritating news regardless of the limitation of law and moral constraints, finally embarking on a dead end. Thus, the great is not self-appointed, and press freedom beyond legal and moral is shameful(Sharma, 2009).In the third place, the News Corporation scandal motivates other organiz ations to pay more attention to CSR instead of just thinking of profit. In order to absorb in as many customers as possible, the News Corp ignored the original target of media corporations and took all actions to obtain explorative news regardless of the interest of its stakeholders. The organization is not alone in society, and it needs to undertake the theme of serving people. Only in this way, can it become popular and successful.Just like IKEA, Novo Nordisk and other organizations, they prefer to work out a CSR indemnity after a media scandal(Jiraporn et al. , 2013). 2. 2 analyzing the importance of CSR Firstly, CSR is important for corporate financial performance according to the News Corp scandal(Inoue and Lee, 2011). Just as Inoue and Lee (2011) said, CSR is a tool to increase corporate long-term profits through a little increase of cost in short-term. They emphasized the long-term benefits of CSR and excessive attention to short-term profits may lead to a failure.For exampl e, the profits of the News Corp dropped sharply after eavesdropping behavior. In contrary, the event smashing refrigerator of Haier won the trust and support of customers, got a better reputation and more performance, although it increased the total cost in a period at some degree. Thus, CSR is meaningful to im switch off corporate core competitiveness, inspire staff to be more enthusiastic and creative and attract more financial institutions to provide funds, thus impart to the long-term business performance of enterprises.Secondly, the application of CSR is closely related to corporate sustainability(Choi et al. , 2010). Just as Gomez-Haro et al. (2011) once said, CSR is a standard for an organization to measure the influence of corporate decisions and activities on society and natural environment. They emphasized that strategic CSR is important for an organization to obtain the dominate power to occupy marketplace and develop a sustainable future. Their views stress the relation ship between CSR and sustainability, and explain the value of CSR during the process of operation, except that it did not point out the focus of CSR.In the economic system of high globalization, during the pursuit of business performance, environmental pollution, product quality, labor safety and other issues has been unable to be separated from enterprises(Tan-Mullins and Mohan, 2013). According to the News Corp scandal, it is obvious that stakeholder interests cannot be ignored and CSR has become the main trend of business continuity. Undertaking social responsibility for stakeholders, enterprises can set up a good corporate construe except for enhancing cohesion and core competitiveness, thus ensuring the sustainable development of enterprises.Major food safety accidents of Melamine, excessive odor emissions of Michelin tire factory(Cobert, 2009), Foxconn sweatshops event(Watch, 2010) and so on all prove the importance of CSR to corporate sustainability. Thirdly, CSR is valuable to balance the relationship between economic development and social harmony(Carroll and Shabana, 2010). Smith (2010) said all businesses should aim at fully grown back to those who make corporate objectives come true. In his opinion, CSR is a performance to return the community through volunteerism or sponsorships or other causes.What corporations do should comply with the situation of community only in this way can corporations be sustainable and successful. In other words, CSR pays much attention to common progress, and persists to keep the physical structure between economic development and social harmony. The News Corp excessively emphasized economic profits and ignored the demands of social development, and then it paid. In contrast, as a company equipped with a strong sense of social responsibility, Motorola stressed the companys positive interaction with their environment(Blocker et al., 2011), which gains high assessment of the international community.Question 3 discussin g the leadership during the process of promoting business ethics and CSR Following the News Corporate scandal and other business scandals, the society has upgraded the standards for corporates that expect to establish great power. Just as Qualman (2012) once said, businesses have to work with transparency in order to obtain long-term activities from consumers and attention to the consistency of corporate words and behaviors should be stressed.Therefore, ethical leadership must be emphasized during the process of promoting business ethics and CSR(Becker, 2013). It is necessary to point out that ethical leadership is a soft leadership and it focuses on making use of reasonable amount of authority in every condition to solve issues(OToole and Mayer, 2013). Ethical leadership is beneficial to cultivate great corporate culture, and put the principles of business ethics and CSR into corporate environment(Sheldon and Park, 2011), which makes employees feel the value of ethics and CSR at an ywhere.From the point of ethical leadership, leaders need to regulate themselves according to ethics and then influence others to follow the regulations of ethics and CSR. Business ethics, ethical leadership and CSR should become inseparable concepts during leaders management(Ardichvili and Jondle, 2012). Corporate leaders have twain external effect and internal effect, so how they behave is closely related with the interests of consumers, employees, suppliers, government and other stakeholders.Protection for stakeholders is an important standard to judge the attention of a company to business ethics and CSR, which also proves the value of ethical leadership when promoting ethics and CSR. Whats more, appropriate social responsibility druthers of leaders makes great piece to fulfilling business ethics and CSR(Sharma et al. , 2011), so it is necessary to display the value of social responsibility orientation during the process of promoting business ethics and CSR.In other words, le aders have to regulate their social responsibility orientation in leadership framework and make use of this orientation to promote business ethics and CSR(Crittenden et al. , 2011). Wheelen and Hunger (2010) considered that, as the firms major decision-makers, business leaders have more opportunities for businesses to determine the tone of business ethics, the degree of fulfillment of CSR has a great relationship with the value orientation of business leaders. From this point of view, leaders have to try their best to comply their social responsibility orientation with the regulations of business ethics and CSR.In addition, leaders should provide guidance for important corporate actions and make all operations suitable to business ethics and CSR so as to gain more support and expand the influence of business ethics and CSR(Brunk, 2010). Conclusion According to the above analysis to business ethics, CSR and leadership, it is obvious that business ethics is quite valuable for expandin g its fame, absorbing in more consumers and exploring foreign markets and so on, but it needs to be pointed that it may increases the total cost in short-term and bring about capital risks sometimes.It is also apparent that CSR is meaningful for corporate financial performance, sustainability and the relationship between economic development and environmental protection. In addition, leadership plays an indispensable role in promoting business ethics and CSR, but it may also ruin corporate ethics and CSR owing to unreasonable utilization to ethical leadership. Therefore, it can be concluded that business ethics and leadership should be paid attention and appropriate ethical leadership should display its guidance role.In our company, there are a lot of employees and factories that produce tires. It is cognise that rubber releases bad gas and factories discharge polluted water, which both ruins the health of workers and environment. Under this background, if the health of workers is cared and strict regulations are worked out for pollution, our company go forth get more support from workers and the society. Recommendation After theoretic analysis, it is necessary to provide some realistic and feasible recommendations. On one hand, business ethics and CSR should be taken into strategic management.When working out some economic policies or strategic plans, companies should consider whether the policy or plan hurts the interest of stakeholders, damage natural principles and excessively emphasizes economic target regardless of social development or not. On the other hand, establish a monitoring and evaluation implement is recommended in the leadership team. This system is mainly used to supervise leaders actions and regulars assess their behaviors according to corporate ethics and CSR so as to strengthen ethical leadership. (Word accounts 2699 words)

Movie Journals

diary 1 Whats cooking? pardon the representation of women and their roles in their families. Explain the role of the generational conflict. How does the setting design tell ab bulge the contributions? The photograph Whats cooking? is about four various families all coming from various cultures, but focuses to begin with on the women of each. We have a Jewish nonplus who is trying to accept the position that her daughter is a homosexual and trying to eases the acceptance. Then we have the Nguyens, the mother dramatizes the Vietnamese traditions really tightly and depends on her eldest son to help guide her young children.In the Avila family we regardElizabeth, whose macho husband has left her for her cousin and has run aground consolation with a colleague. In the Williamses the wife is dealing with an infidelity from the husband as well as putting up with an annoying mother in law. These family problems portray us that every women has the identical problems no matter wha t ethnicity they argon or culture. Throughout the depiction we listen generational conflict. In the Williamsess family we see a conflict between the wife and the mother in law when they were arguing if the turkey was ready.The mother in law has diametric ways, old styles of cooking and preparing food, which causes them to reposition heads. Also in the same family the father and son dont see substance to eye in the sons education. The son wants to go to Howard, an all black college. His father doesnt want that for his son he tells him that he would rather like him to go to a University like UCSB and be small-arm of the white antique capitalistic society, but the son olfactory perceptions that it is more important for him to cope with his minority group. The visual designs used to portray the houses tell us a lot about the families.The Williamses house is the biggest out of all the homes. This shows that they are of a high socioeconomic class. When compared to the Nguyens we see that the Nguyens are of a lower socioeconomic class. We similarly see this when they are preparing the mash potatoes for the thanksgiving dinner. The Nguyens use their hands to mash the potatoes while the Williamses use a blender to mash it for them. The Nguyens are clinging to their Vietnamese traditions so tightly they havent a clue how to listen to their children. The Seeligs house decor seems to be old school insinuating that they have lived in the neighborhood for a while.They seem to be conservative keeping their old traditions. We see this when the father doesnt want his daughter to tell his relatives that she is a lesbian and has a girlfriend. Journal 2 Hairspray Explain how Tracy challenges the ideology of her time. Explain how she challenges the way women are perceived. Explain how color acts as a way of explaining the world of the film. Tracy challenges the ideology of her time in many different aspects. Tracy lives in the 60s when society was dominated by a white pa triarchal system. Segregation was still going on but it was on its last terms.Tracy challenges the system by questioning why the African Americans only danced one a month on Negro day and why they couldnt dance along side with the white kids. Questioning the Jim Crow laws that were a big part of society at the time, which kept people segregated. She also challenges the patriarchal society when she confronts the police which are the repressive state apparatus and how they dont allow integration. Tracy challenges the way women are perceived in films. In about films women are these skinny tall beautiful women who compass what they want. In hairspray Tracy is the opposite of this norm that has been adapted for women.She is a short big girl who is in dear with the most attractive guy at school. Who in reality has no chance with him what so ever. Despite all of this she makes him fall in love with her repugn the norms. Showing us that anything is possible to achieve and that the true c haracter of a person is defined by inner qualities rather than outer ones like skin, color, pasture size or hair style. The colors in the movie play an important role on how the movie is seen. We see that the Corny collins show is in black and white showing us that it is an example of how close minded people where at that time in history.At the end when the Corny Collins show gets rid of the segregated dancing we see Queen Latifah wearing a bright golden clothing to symbolize that they have reached their ultimate goal, which is to at long last be assimilated and accepted into society. Journal 3 The Birds Discuss The Birds through an analysis of the male person surveys. How is Melanie Daniels place taken from her? why? When we analyze the film The Birds through the male gaze we see through the eyes of Mitch, or Mitchs shoot for of view as he seems to view her for her sexuality and aggressiveness.She seems to want Mitch to watch her and goes out of her way to be sure that he does . In another scene as she is holding the lovebirds in the elevator she seems in some ways to be posing for the gentleman in the elevator with her. As she leaves the elevator her eyes seem to go to the side in a very cautious look to see if the man is watching as she leaves the elevator. She seems to know the authority and desire of her sexuality as we view her through the camera lens in the same way as one might view someone who is on display and want to be seen.This especially can be seen when Melanies has stimulate on to Mitch in some highly suggestive manners and he tells her, back in your gilded cage Melanie Daniels. He seems to suggest that she in fact is too much for him to handle sexually and mentally, and the bird cages symbolizes that maybe Melanie sees herself as one of those love birds and seeks love, and freedom from her own cage in life. Melanie is seen as a woman of strength and grace who is not afraid to go after what she wants and does not care who knows it.She i s also aggressive and daring, as well as self-supporting which makes all of these things admirable to some men, but could also frighten some men. The film seems to follow the ideology of investigate and punish we see this when Melanie is stripped from her power for defying the patriarchal rules. Melanies power is taken away when she gets attacked by the birds. When she is getting attacked she is moaning in a sexual way as if she were getting raped by the birds. Symbolizing how she is macrocosm stripped from her aggressiveness and confidence. Showing us how vulnerable she really is.The final step that tells us that her power has been completely removed is when we see her red nails ruined. Mitchs mom no longer sees her as a threat of taking Mitch away from her so she holds her trying to console her, approving of her. Journal 4 sundown Boulevard Is Norma Desmond a sympathetic character in the film? Who has the most power in the film? In the film Sunset Boulevard Norma Desmond is see n as a sympathetic character towards the middle of the film when the audience notices that she is stuck in her past, living in a dream, waiting for the cameras.It is her egoistic mental attitude and her actions that make the audience feel bad and sympathize her. We can also sympathize when she cuts her wrist because Joe has gone out to work on the movie hired hand with Betty and thinks he is cheating on her. She makes the audience feel bad for her. When she finds out that there will be no film she goes crazy in agnosticism In the last scene we see a fade in of Normas face this causes her to look and seem crazy with the help of the lighting. This makes the audience feel somewhat compassionate and sympathy for her. It seems that Norma Desmond has the most power in the film.Sunset Boulevard being a film noir takes part of the castration complex. She is seen as a predatory animal aggressive and waiting for its prey so she can attack it making her a femme fatales. We see this when sh e sees Joe. She jumps all over him tries to buy him, making him want to stay. Joe being in the financial crisis that he was in made him vulnerable and susceptible to Normas control. Also in the film we see when she goes and buys Joe a suit, not penetrating what to get the store owner tells him to get the expensive one that she is paying making him not be the provider. It is seen again when Joe goes to the pharmacy to buy Norma cigarettes.She hands him the capital and Joe seems to be hesitant to take it. It seems that his male provider ego seems to not approve of the money given to him by Norma. It gets to a point that Joe actually starts to get use to the life he has. We can see Norma is in control over Joe because she takes away his life because he is living her. Making her have the power in the film. Journal 5 Out of the past Why is Jeff Bailey considered a classic film noir anti hero? Discuss the use of the male gaze in reference to the two central females, Kathie and Ann. Jeff Bailey is seen as a classic film noir anti hero in Out of the past.An anti-hero is a protagonist that does not always make choices that audiences would make, or has different, more unsound motivations than a typical hero. He can be shown to make poor or unethical choices all the same is still intended to get the sympathy of the audience. This adds a complexity to the films and challenges many of traditions of literature and cinema. This makes us question the character of this protagonist, and yet we are forced to follow and empathize with him, because he carries the story. Jeff perfectly fits into this category. When he has the flashback of when he goes to Mexico to go look for Kathie who has taken 40000 dollars.Kathie being a perfect example of a femme fatale seduces him and makes him fall in love with her. She does this so he doesnt turn her in, messing with his job orders. At the end Jeff is killed by Kathie because he has ran away with her not following the norms that the audi ence would expect, send a subliminal message on the consequences if one were to act in that manner. The male gaze is used in the film and we can see it in the two central female actresses Kathie and Ann. The way they are portrayed through the male gaze is very different. We see Ann as a non seductive woman, that has an beatific face.The clothes she wears are not revealing and leave room for imagination. While Kathie on the other hand is seen as a very seductive women that does whatsoever it takes to get what she wants. Also the lighting used for each actress is different. For Kathie at times we see she is in a dark background and we cant see her face. Making her a mysterious, cynical character. While Ann on the other hand is always in the light and we see her face symbolizing innocence. The angles at which they are filmed are also a factor. When Kathie is being filmed we see that she is looking down at Jeff, making her look superior.With Ann she is always at eye level with Jeff. J ournal 6 Is Run Lola, Run truly a feminist film or does the male gaze still apply to this film? The film Run Lola, Run follows the feminist film theory but still has some male gaze point of views. The lead female character in Run Lola Run, is the heroine. Lola comes to the rescue of her boyfriend Manni, which disrupts the popular model, norm of men portrayed as the heroes of society. This film is set in Berlin where Manni loses a small serving of his mob-bosss money and relies on Lola to save his life.She has twenty minutes to gather 100,000 and meet him at a designated location or Manni will be killed. not only is Run Lola Run unique because the woman is the heroine, but also because it combines animation and hand held camera to create a variety of experiences through different types of shot. The literacy design is coupled with a limited dialogue and more action, the film goes against the norm of popular cinema. Lola shows the audience that she has the power to shape what is going on around her, throughout each round. During the course of the film we see the game theory in action, there are three realities that play out.Each segment concludes with a different outcome. The choices of the main characters, Lola, alter the ending. Lola proves to be a strong and compelling person through examples such as her glass shattering scream. At one point it seems to own mystic powers, when it affected a game of roulette that Lola needed to win in order to acquire money to save Manni. There are other aspects of Lolas power, as in her intense running throughout the entire film, robbing her father as well as helping in robbing of the supermarket, and preservation another mans life by simply holding his hand.Although she is white and slender, has bright dyed red hair, is very athletic, has tattoos, and is not the average beauty. The film not only challenges societal idea of what a woman should be, it also undermines the way films are commonly used to construct a reality for the attestant by going against the norm of shots, narrative, time, and the power of the individual. Lola is the writer of her own life, she takes an active role in her story as well as others.

Phu Nhuan Jewelry Essay

In April 28th, 1988, Phu Nhuan Jewelry Trading Store was founded with an investiture of only VND 14 one million million million and its first 20 employees. In 1990, this founding store became Phu Nhuan Jewelry, Fine Arts and Currency Exchange Company, being under direct control of Financial administration of Ho Chi Minh City Committee. Phuong Hoang Gold Bar was also launched then. In 1992, the company was renamed Phu Nhuan Jewelry occasiont Stock Company. This stage witnesses great changes with bold investment in Italian technology production line.In the same year, the company also co-founded dingdong A Bank and formed a joint ship with Phu Nhuan House Trading and Devepment Company. In 1995, PNJ expanded its activities into motorbike trading as a Head of Honda. Also in this year, PNJ set up the first fumble logistics in Ho Chi Minh City, VINAGAS. Since 1998 till 2003, Branches in Ha Noi, Da Nang and Can Tho were set up while number of stores in Ho Chi Minh City kept increasing. Not only spreading nationwide, PNJ also exports to foreign markets, starting with Singapore, Malaysia and the US.In 2003, PNJ co-found Dong A Real Estate Join Stock Company and be shareholder of SG Fisheries Joint Stock Company. In Jan 2004, PNJ changed into a new type of business Joint Stock Company, under the estimable name Phu Nhuam Jewelry Joint Stock Company. In 2005, PNJ re-launched PNJSilver and launched a premium trademark CAO Fine Jewelry. In 2007, PNJ was ranked Top 200 Largest Enterprises in Vietnam by United Nations Development Programme (UNDP).In 2008, PNJ launched new logo and re-launched gold bar trademark under a new name Phoenix PNJ- Dong A Bank. In present, PNJ keeps growing in all aspects manufacturing system investment and workforce development, export market expansion to Europe, U. S. A, Australia, etc. The companys addition has raised up to 2. 000 billion VND, the number of employees has now been nearly 2. 000 people and PNJ has an international-standard jew elry factory with 1. 000 professional goldsmiths.Until now, PNJs retail system has expanded to more than than 100 stores nationwide. PNJ is very proud of its famous and prestige jewelry brands in Vietnam, which include the PNJ Gold, PNJSilver, CAO Fine Jewelry and Phoenix PNJ DongA Bank Gold Bar. PNJ has received varied awards throughout years, such as Top 500 Retailers in Asia-Pacific Award (from 2004 until now), High Quality Vietnamese Products Award for 12 consecutive years from 1998 to 2009, Vietnamese Golden Star Award, Best Vietnamese Brand Award, Vietnamese Quality Award, etc.PNJ was the first local jewelry company exporting products overseas. Since 1995, PNJ jewelry products beget been introduced in Hongkong Jewelry Fair, as well as exported to Denmark, Germany, U. S. A, Australia and start entering Dubai market. Throughout 21 years of development, PNJ has successfully completed business tasks, taken grapple of social community, contributed for the Vietnamese jewelry in dustry, and also contributed to the development of the economy society of the country.

Bio 201 Final Review

Which of the succeeding(a) is most likely to occur when a tumor-suppressor ingredient is mutated? The tumor-suppressor gene and resulting protein may lose its exit and world power to suppress prison jail cell proliferation. Mutations prat produce a polypeptide with growingd function. TRUE ________ bunghole convert proto-oncogenes into oncogenes. Nonsense editions Most hu valet de chambre embryos that ar aneuploidy atomic number 18 spontaneously aborted in the first trimester. Horses and donkeys atomic number 18 almost related species that rear interbreed. However, the offspring produced argon usually sterile and derriere non reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never utilise by organisms as a means of reproduction. trumped-up(prenominal) Which of the pastime accurately gives the distri besidesion of pheno theatrical roles produced from a cross of discolour dwarf pea plants that are heteroz ygous for flower blazon and plant crown? 63 purple dwarf 28 purple tall 27 vacuous dwarf 7 white tall A man with specimen baldness and a woman who has no baldness get hold of a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this feature is not a symptom of a medical condition.If her m other does not have pattern baldness, the daughters genotype is ________ and her mothers genotype is _____________. BB, Bb If a pink snapdragon is self-fertilized, the offspring are redness, pink, or white. What type of heritage pattern does flower color exhibit in this font? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the evolution egg cells is cal take agnatic effects.If a testcross for cardinal unalike traits produces more nonrecombinant than recombinant offspring, then the alleles for the devil traits are on the same chromosome. An episome is a plasmid that can integrate into the bacterial genome. viral genomes essential always be excised from the bacterial chromosome before viral components can be produced. infatuated A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. an F factor What can be inferred from an organism that has undergone a gene knockout? The GMO is a homozygote and the clond gene carries a mutation.Which of the following is an example of a clone on the organism level? identical twins Following treatment with labour enzymes, what military operation would be used to isolate deoxyribonucleic acid fragments of different lengths? -gel electrophoresis At what phase of the cell motorcycle does p53 halt cell division if it senses deoxyribonucleic acid abuse? G1 Certain types of cancer are caused by viruses. TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be beepegorize as two aneuploid and trisomic. At the end of light reflex I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the kinetochore located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your transmissible counseling center because she knows that Huntington unhealthiness occurs in members of her family. Her enatic grand draw was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her fathers side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain all(a) of the items listed are correct. In bi citeal inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. sham plane gene transfer occurs when one species of bacteria takes up the deoxyribonucleic acid of another species that released the DNA when it died. TRUE Which of the following does not contribute to the infectious ability of prions? Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and convert over 150 genes. This suggests that their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants evenhandedly easier than the production of transgenic animals? Plant cells are totipotent. Which of the following is an gain of molecular pharming? The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene ATGGCCGGCCCGAAAGAGACC Mutated gene ATGGCCGGCACCGAAAGAGACCNormal protein Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein Met-Ala-Gly-Thr-Glu-Arg-Asp base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. FALSE A gene created from the fusion of two gene fragments is considered a chimeric gene. If a cell contains 20 units of DNA during G2, it entrust have 40 units of DNA in S. FALSE In a tetraploid species, a euploid individual would have ___se ts of chromosomes. 4 For either given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a wizard-factor cross? F2 generation / result of P cross A cross of a true- engender smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not twain. FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. competent Baculovirus genomes a re 133. 9 kb long and encode over 150 genes. This suggests that their protein structures are very complex.bacteria can turn DNA in the midst of strains of the same species and between different species. TRUE A research worker wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cells metabolic machinery. Which of the following diseases affect DNA repair? xeroderma pigmentosum Cancers acquire from a undivided cell. TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with form vision and hazel eyes (Hh). Their three children all have blue eyes and normal visio n.What is the probability that their next child lead have blue eyes and be nearsighted? 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? Cross the red plant with a white plant to see if any white plants appear. When some recessive serviceman diseases are present in the heterozygous state, incomplete dominance occurs. TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because All of the statements given are true. Quantitative traits are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and length are linked, what would be a possible ratio for the F2 population? 5 long-haired black, 4 short-haired w hite, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is a prion It has been difficult to create an effective vaccine against HIV because run off transcriptase cannot correct its errors. TRUE Which of the following is a possible use for gene re-create? All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? Every band matches. What is required for a group of clones to be considered a contig? The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? nonsense mutation When cancer cells have the ability to migrate to ot her parts of the body, they are said to be metastatic. The process by which haploid cells are produced from diploid cells is called meiosis In a haploid dominant species the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that alleles for a given trait are distributed randomly among an individuals gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? two parents heterozygous purple A couple has five sons. What is the probability that their next child leave behind be a girl? 50% If the recombination frequency between gene A and B is 10 out of carbon offspring, gene A and C is 30 out of 100 offspring , and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. 3,2Drugs that are HIV protease inhibitors restrain HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. TRUE The entire collection of a species proteins is known as its proteome Which of the following pollutants could be reduced with the use of bioremediation? All of the choices are correct The main goal of polymerase chain reaction ( PCR) is to generate many copies of DNA. TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? a frameshift mutation, producing a different amino acid sequence whole Somatic cell mutations are heritable. FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) oncogene The formation of the bivalent during meiosis contributes to the genetic diversity of a species.A male is heterozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. 75% freckled, 50% heterozygous A person with p ipeline type O can give furrow to people of any blood type. TRUE Epistatic gene interactions do not follow Mendels laws of inheritance. FALSE Which of the following statements correctly describes a quantitative trait? People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. a sex pilus, single strand of DNA Integrase cuts the viral genome and is required for both prophage and provirus formation.Which of the following is an advantage of cDNA libraries? cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a dem odulator of DNA damage TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. FALSE In mammals, males are ________ and females are ____________. hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. 4 In plants, most chloroplasts are hereditary from the maternal plant because maternal gametes contribute the most __________ to the zygote. cytoplasm Place the following events of bacterial transformation in order from first to last. DNA regaining b an enzyme joins F factor DNA ends c sex pilus shortens d DNA transfer e an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the genes champion region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. two haploid, 4 haploid Which of the following mutations will not alter the amount of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue course with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. TRUE The sex of all animals is determined by chromosomes. FALSE Albinism in most animal s is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researchers success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of correspond 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? Couple 1, Baby Joe or Baby Jane Couple 2, Baby Jane The single-factor crosses performed by Mendel support the observation that the two alleles for a given gene are distributed randomly among an individuals gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission All of these statements are correct. The chromosome must be ___________ i n order to fit into the bacterial cell. supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal JAYBIRDCATPAW Mutated JAYBIRDCATPAW -nonsense Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. checkpoint proteins In mitosis, the main difference between plant and animal cells is that plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? the childs maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and straightway converts it back to a correct structure.Which of the following DNA repair systems is responsible for the correction? direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following on that point are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the heigh t of a person with the genotype (AA, Bb, cc, DD)? 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant rescue could have been caused by addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? Each colonization began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone gene amplification. All of the following are chemical mutations EXCEPT X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? Triple X syndrome Prokaryotes include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a holy terror to human health due to All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. S Sexual life cycles include both haploid and diploid stages. TRUE Which of these is not a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher perform if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II di ffers from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an bare X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the other parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce Labradoodles is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendels laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequ ences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. chthonic what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and metaphase II is the forepart or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgans experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed in concert? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breeding a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow Texas truelove rose with a true-breeding Ruby red rose, you get all red roses. But when you cross a Texas Beauty yellow with the yellow variety Jealousy, you get a 97 ratio of red to yellow flowers What can you conclude from these results? There are epistatic interactions bet ween at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scientist has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a equable phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky en ds of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A specie s that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The atomic membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in the inactivation of the paternal allele in the offspring. A small amount of DNA is amass from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? polymerase chain reaction (PCR) Polyploidy in plants All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? 5? -TCCGGA-3? 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in excess fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the mans father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.